View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_23 (Length: 272)
Name: NF10511_low_23
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 34 - 267
Target Start/End: Complemental strand, 2716367 - 2716137
Alignment:
| Q |
34 |
aaattattatagatgtttacgtgccagttcagttttgtgtccatgtttgggtgnnnnnnnnnnactacattagactcaaaacatggattaaggaatttct |
133 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2716367 |
aaattattatagatgtttacgtgtcagttcagttttgtgttcatgtttg--tgttttttttttactacattagactcaaagcatggattaaggaatttct |
2716270 |
T |
 |
| Q |
134 |
gagtatttctgttgacattttattaaattttaattcccatcagtcacaaaagttcttcaacaggatattggtgtttaaaatttctttctaccacttcata |
233 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2716269 |
gaatatttctgttgacattttattaaattttaattcccatcagtcacaaaagttcttcaacaggataatggtgtttaaaatttctttttaccacttcat- |
2716171 |
T |
 |
| Q |
234 |
aatgaatttacagatatagatatcctttgcttct |
267 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |
|
|
| T |
2716170 |
aatgaatttacatatatagatatcttttgcttct |
2716137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 164 - 267
Target Start/End: Complemental strand, 3356358 - 3356255
Alignment:
| Q |
164 |
taattcccatcagtcacaaaagttcttcaacaggatattggtgtttaaaatttctttctaccacttcataaatgaatttacagatatagatatcctttgc |
263 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| | | || ||||||||| | ||||||||| |||| |||||||||| |||||||||| || ||||| |
|
|
| T |
3356358 |
taattcccatcggtcagaaaagttcttcaacaggacaatagtatttaaaattacgttctaccacgtcatgaatgaatttatagatatagatgtcttttgc |
3356259 |
T |
 |
| Q |
264 |
ttct |
267 |
Q |
| |
|
|||| |
|
|
| T |
3356258 |
ttct |
3356255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University