View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10511_low_23 (Length: 272)

Name: NF10511_low_23
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10511_low_23
NF10511_low_23
[»] chr4 (1 HSPs)
chr4 (34-267)||(2716137-2716367)
[»] chr7 (1 HSPs)
chr7 (164-267)||(3356255-3356358)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 34 - 267
Target Start/End: Complemental strand, 2716367 - 2716137
Alignment:
34 aaattattatagatgtttacgtgccagttcagttttgtgtccatgtttgggtgnnnnnnnnnnactacattagactcaaaacatggattaaggaatttct 133  Q
    ||||||||||||||||||||||| |||||||||||||||| ||||||||  ||          ||||||||||||||||| |||||||||||||||||||    
2716367 aaattattatagatgtttacgtgtcagttcagttttgtgttcatgtttg--tgttttttttttactacattagactcaaagcatggattaaggaatttct 2716270  T
134 gagtatttctgttgacattttattaaattttaattcccatcagtcacaaaagttcttcaacaggatattggtgtttaaaatttctttctaccacttcata 233  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||     
2716269 gaatatttctgttgacattttattaaattttaattcccatcagtcacaaaagttcttcaacaggataatggtgtttaaaatttctttttaccacttcat- 2716171  T
234 aatgaatttacagatatagatatcctttgcttct 267  Q
    |||||||||||| ||||||||||| |||||||||    
2716170 aatgaatttacatatatagatatcttttgcttct 2716137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 164 - 267
Target Start/End: Complemental strand, 3356358 - 3356255
Alignment:
164 taattcccatcagtcacaaaagttcttcaacaggatattggtgtttaaaatttctttctaccacttcataaatgaatttacagatatagatatcctttgc 263  Q
    ||||||||||| |||| |||||||||||||||||| | | || ||||||||| | ||||||||| |||| |||||||||| |||||||||| || |||||    
3356358 taattcccatcggtcagaaaagttcttcaacaggacaatagtatttaaaattacgttctaccacgtcatgaatgaatttatagatatagatgtcttttgc 3356259  T
264 ttct 267  Q
    ||||    
3356258 ttct 3356255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University