View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10511_low_32 (Length: 250)

Name: NF10511_low_32
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10511_low_32
NF10511_low_32
[»] chr4 (2 HSPs)
chr4 (1-131)||(39918352-39918482)
chr4 (180-242)||(39918241-39918303)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 39918482 - 39918352
Alignment:
1 caccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39918482 caccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggc 39918383  T
101 tagttttgtgaaaacagggacatgattggaa 131  Q
    |||||||||||||||||||||||||||||||    
39918382 tagttttgtgaaaacagggacatgattggaa 39918352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 39918303 - 39918241
Alignment:
180 ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39918303 ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct 39918241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University