View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_34 (Length: 241)
Name: NF10511_low_34
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 11401055 - 11401279
Alignment:
| Q |
19 |
agtttactcgttaacagaggattgaaaatagagtgtttgaatcttagtagcattcctgcgtactcctcgagtcacacactgagatgcataaacaaacagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11401055 |
agtttactcgttaacagaggattgaaaatagagtgtttgaatcttagtagcattcctgcgtactcctcgagtcacactctgagatgcataaacaaacagt |
11401154 |
T |
 |
| Q |
119 |
ttcaattgaaaaattgtgaccgtcaatatttataaatgtcaaccaaaatcgtgcttctgagcctagtagatagactccataatggagcctgg--cacaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11401155 |
ttcaattgaaaaattgtgaccgtcaatatttataaatgtcaaccaaaatcgtgcttctgagcctagtagatagactccataatggagcctggcacacaca |
11401254 |
T |
 |
| Q |
217 |
atgcaccactttatataaaaaagtt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11401255 |
atgcaccactttatataaaaaagtt |
11401279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University