View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_37 (Length: 227)
Name: NF10511_low_37
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_37 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 11401501 - 11401276
Alignment:
| Q |
1 |
aaataaatatcgactattcgcattgtgaaattaggatttatgtgtttatttgaatttctatttgtgtttcttcaaggtatgggggtatgttgtgtgagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401501 |
aaataaatatcgactattcgcattgtgaaattaggatttatgtgtctatttgaatttctatttgtgtttcttcaaggtatgggggtatgttgtgtgagtg |
11401402 |
T |
|
| Q |
101 |
tggatcttaaggattgatgtttgagttctacttgttagattttatgttatgacatagataatttgatcatgtttttacttttactctccaaagtaacatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11401401 |
tggatcttaaggattgatgtttgagttctacttgttacattttatgttgtg-catagataatttgatcatgtttttacttttactctccaaagtatcatt |
11401303 |
T |
|
| Q |
201 |
gtgtgcagattaatccttatattaact |
227 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
11401302 |
gtttgcagattaatccttatattaact |
11401276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University