View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_42 (Length: 212)
Name: NF10511_low_42
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 13 - 117
Target Start/End: Original strand, 13981764 - 13981869
Alignment:
| Q |
13 |
agagagtaatacaaggtaaa-ttttagtgtgacttcaaaagtttagtctagctaaaaatgtggtatggtttatggttcagacttatgggaaaagtaggta |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13981764 |
agagagtaatacaaggtaaagttttagtatgacttcaaaagtttagtctagctaaaaatgtggtatggtttatggttcagacttatgggaaaagtaggta |
13981863 |
T |
|
| Q |
112 |
gtaatt |
117 |
Q |
| |
|
|||||| |
|
|
| T |
13981864 |
gtaatt |
13981869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 13981915 - 13981954
Alignment:
| Q |
157 |
aaatcttgaggcaataggtcccacatgtaagaggagcaat |
196 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
13981915 |
aaatcttaaggcaataggtcccacacgtaagaggagcaat |
13981954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University