View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_high_1 (Length: 348)
Name: NF10513_high_1
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_high_1 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0200 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 330
Target Start/End: Complemental strand, 28746 - 28415
Alignment:
| Q |
5 |
gaaaatgagaataaaaaggttttggggactataggattggttttcaaattcaagtcaccaattcttgaatacattactataagttgtatatatatttcta |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28746 |
gaaaatgagattaaaaaggttttggggactataggattggtttttaaattcaagtcaccaattcttgaatacattactataagttgtatatatatttcta |
28647 |
T |
|
| Q |
105 |
ttgcttaggattttcatgatttgaaattttgaagttctatttcttggtatattgtattttgtaaataaatattttgaatggatgagttttactagaagtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28646 |
ttgcttaggattttcatgatttgaaattttgaagttctatttcttggtatattgtattttgtaaataaatattttgaatggatgagttttactagaagtt |
28547 |
T |
|
| Q |
205 |
catgtgttttattttggattttagaattacctaccagtttaa------nnnnnnnnnnnnnnnncttttgaatcaaattggcataacaatcactatgtca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28546 |
catgtgttttattttggattttagaattacctaccagtgtaagggtgtgtgtgtgtgtatgtgtcttttgaatcaaattggcataacaatcactatgtca |
28447 |
T |
|
| Q |
299 |
agaagtttcatcataatcttagtgttctaaat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28446 |
agaagtttcatcataatcttagtgttctaaat |
28415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University