View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_high_2 (Length: 264)
Name: NF10513_high_2
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 15170142 - 15170007
Alignment:
| Q |
7 |
ggagaagcaaaggcagaatcggagaaggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttggattgtgnnnnnnn |
106 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15170142 |
ggagaagcaatggcagaatcggagatggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttgaattgtgtttcttt |
15170043 |
T |
|
| Q |
107 |
nnactgttggtttggagtgtttgaaaatttctcttctcc |
145 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
15170042 |
ttac---tggtttggagtgtttgaaaatttctcttctcc |
15170007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 174 - 264
Target Start/End: Complemental strand, 15170007 - 15169916
Alignment:
| Q |
174 |
cagttaacggctgctccgtacccaacggcagttaatttttgttgtcctagcg-cagttaattgttgttacgttcttttcaagcataactagc |
264 |
Q |
| |
|
|||||||| |||||| ||| ||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15170007 |
cagttaactgctgctttgtatccaacggcaattaattttggttgtcctagcggcagttaattgttgttacgttcttttcaagcataactagc |
15169916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University