View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_high_5 (Length: 227)
Name: NF10513_high_5
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_high_5 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 28945 - 28719
Alignment:
| Q |
1 |
aggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacagatgcaaacattgtg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28945 |
aggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacagatgcaaacattgtg |
28846 |
T |
 |
| Q |
101 |
ttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataagatcgatagaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28845 |
ttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataagatcgatagaaag |
28746 |
T |
 |
| Q |
201 |
aaaatgagattaaaaaggttttgggga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28745 |
aaaatgagattaaaaaggttttgggga |
28719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University