View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_1 (Length: 522)
Name: NF10513_low_1
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 39298928 - 39299171
Alignment:
| Q |
16 |
caccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298928 |
caccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaa |
39299027 |
T |
|
| Q |
116 |
caactgcagacttggctttctccgccacaggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299028 |
caactgcagacttggctttctccgccacaggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttg |
39299127 |
T |
|
| Q |
216 |
tgttttctcaagagttgcatctttggcttgtgctgctttctcca |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39299128 |
tgttttctcaacagttgcatctttggcttgtgctgctttctcca |
39299171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 335 - 420
Target Start/End: Original strand, 39299247 - 39299332
Alignment:
| Q |
335 |
catacctctcttgtgctgctgagattgcgtccatttcattttgttgtgcttggtttctatacttccctatctcttccaaagacatt |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299247 |
catacctctcttgtgctgctgagattgcgtccatttcattttgttgtgcttggtttctatacttccctatctcttccaaagacatt |
39299332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 451 - 514
Target Start/End: Original strand, 39299363 - 39299426
Alignment:
| Q |
451 |
tgttcagcaccactttttcccaacattgcaccttcatttccagcacccgctcttcctctctgct |
514 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39299363 |
tgttcagcagcactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgct |
39299426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University