View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_16 (Length: 243)
Name: NF10513_low_16
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 35 - 225
Target Start/End: Complemental strand, 29442253 - 29442055
Alignment:
| Q |
35 |
gagtaactaataatggtggaacattccctcaatttgcctaaagaaaaaatggtggaacctatttaataatatgctcgacaatcaattttatgtgtgtctc |
134 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442253 |
gagtaactaataatgggggaaccttccctcaatttccctaaagaaaaaatggtggaacctatttaataatatgctcgacaatcaattttatgtgtgtctc |
29442154 |
T |
|
| Q |
135 |
ttttgtcnnnnnnnnnnnnntcaattttacgtg----tctctctcttttatatatatcatttattttgtc----aaagaggatcggtccccgtgagcat |
225 |
Q |
| |
|
||||||| ||||||||| ||| ||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
29442153 |
ttttgtcaaaaaacaaaaaatcaattttatgtgtgtctctctctattttatatatatcatttattttgtcaaataaagaggatctgtccccgtgagcat |
29442055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University