View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_17 (Length: 243)
Name: NF10513_low_17
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 33334355 - 33334579
Alignment:
| Q |
1 |
taacaactaaactaacaataacaacattgttgaacccttgagagttgagtcattgctaagcgaaaaccattgaaaatggcgtaaaacttgaccaacaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33334355 |
taacaactaaactaacaataacaacattgttgaacccttgagagttgagccattgctaagcgaaaaccattgaaaatggcgtaaaacttgaccaacaaac |
33334454 |
T |
|
| Q |
101 |
tagaatgaatcccgatgaagcctgtgtctaaccagcagcacaataattgttgcacatatttccactaaacccatatctactataggattgttgaggaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33334455 |
tagaatgaatcccgatgaagcctgtgtctaaccagcagcacaataattgttgcacatatttccactaaacccatatctactttaggattgttgaggaagt |
33334554 |
T |
|
| Q |
201 |
tgtcatccatattgccttcgatggt |
225 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
33334555 |
tgtcatcgatattgccttcgatggt |
33334579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University