View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_19 (Length: 236)
Name: NF10513_low_19
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 6566060 - 6565851
Alignment:
| Q |
18 |
tttggttggtgatttcttcactggagtgatgactttagccattttcttttcaatagatttctcttctggtattgatgataaggaatcttgtttggaatgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6566060 |
tttggttggtgatttcttcactggagtgatgactttagccattttcttttcaatagatttttcttctggtattgatgataaggaatcttgtttggaatgc |
6565961 |
T |
 |
| Q |
118 |
aattgcttcccatttactagctttctactagaagcacttttggcaagagaaatctgaggcctagtggtagtagaattaagctcactttgagacaatgatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6565960 |
aattgcttcccatttactagctttctactagaagcacttatggcaagagaaatctgaggcctagtggtagtagaattaagctcactttgagacaatgatt |
6565861 |
T |
 |
| Q |
218 |
ttgacctttg |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
6565860 |
ttgacctttg |
6565851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University