View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10513_low_20 (Length: 232)

Name: NF10513_low_20
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10513_low_20
NF10513_low_20
[»] chr5 (1 HSPs)
chr5 (67-165)||(40643992-40644090)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 67 - 165
Target Start/End: Complemental strand, 40644090 - 40643992
Alignment:
67 aattgaggaaaggaaattaaagatctaatccatatccaaagacatcacatccaccatcatctaattgacgactgcaactgaaatgtggaatatcttgaa 165  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40644090 aattaaggaaaggaaattaaagatctaatccatatccaaagacatcacatccaccatcatctaattgacgactgcaactgaaatgtggaatatcttgaa 40643992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University