View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10513_low_21 (Length: 227)

Name: NF10513_low_21
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10513_low_21
NF10513_low_21
[»] scaffold0200 (1 HSPs)
scaffold0200 (1-227)||(28719-28945)


Alignment Details
Target: scaffold0200 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 28945 - 28719
Alignment:
1 aggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacagatgcaaacattgtg 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28945 aggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacagatgcaaacattgtg 28846  T
101 ttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataagatcgatagaaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28845 ttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatataaagttcagaacatgtataagatcgatagaaag 28746  T
201 aaaatgagattaaaaaggttttgggga 227  Q
    |||||||||||||||||||||||||||    
28745 aaaatgagattaaaaaggttttgggga 28719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University