View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10513_low_22 (Length: 226)

Name: NF10513_low_22
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10513_low_22
NF10513_low_22
[»] chr1 (1 HSPs)
chr1 (19-198)||(50070732-50070911)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 50070911 - 50070732
Alignment:
19 agtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtcaatggatagattctatgaannnnnnnctctca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||       ||||||    
50070911 agtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtcaatggataggttctatgaatttttttctctca 50070812  T
119 catctatagagagggtaactaatgtgttgatgacttagcaaatattggtcttagcccgaatcaattcactttgtggaatt 198  Q
    |||||||||||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||    
50070811 catctatagagaggataactaatgtgttgatggcttagtaaatattggtcttaccccgaatcaattcactttgtggaatt 50070732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University