View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_22 (Length: 226)
Name: NF10513_low_22
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 50070911 - 50070732
Alignment:
| Q |
19 |
agtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtcaatggatagattctatgaannnnnnnctctca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
50070911 |
agtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtcaatggataggttctatgaatttttttctctca |
50070812 |
T |
 |
| Q |
119 |
catctatagagagggtaactaatgtgttgatgacttagcaaatattggtcttagcccgaatcaattcactttgtggaatt |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50070811 |
catctatagagaggataactaatgtgttgatggcttagtaaatattggtcttaccccgaatcaattcactttgtggaatt |
50070732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University