View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10513_low_26 (Length: 210)
Name: NF10513_low_26
Description: NF10513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10513_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 52709730 - 52709553
Alignment:
| Q |
18 |
tatagtagtacattttcattgcaattaaagcttttcannnnnnnagaaacagctatttgggattacagcgattctatttttggaaaatctatttgaatta |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709730 |
tatagtagtacattttcattgcaattacagcttttcatttttttagaaacagctatttgggattacagcgattctatttttggaaaatctatttgaatta |
52709631 |
T |
 |
| Q |
118 |
tagctagttcataatgtgtgacagagctgttgatggagattaaatagaaagacattaattcattatctaccatccttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709630 |
tagctagttcataatgtgtgacagagctgttgatggagattaaatagaaagacattaattcattatctaccatccttt |
52709553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University