View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10515_high_6 (Length: 226)
Name: NF10515_high_6
Description: NF10515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10515_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 6 - 202
Target Start/End: Original strand, 36226973 - 36227173
Alignment:
| Q |
6 |
aaatgcttccaccactaaacccgtctttgacttgttattgagaatacattaacaaaatcacgtatttatgaaggaaaaacgtgtggcatgcgactt---- |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
36226973 |
aaatgcttccaccactaaacccgtctttgacttgttattgagaatacattaacaaaatcacgtatttatgaaggaaaaacgtgtgggatgcaacttatga |
36227072 |
T |
|
| Q |
102 |
agcacaaatatttttcgaattaggtgtgtttcggtgtcacgctcgtgtcgctttcgacatcgacatgatatcaatacatataattagattgaattagatg |
201 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||| ||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36227073 |
agcacaaatatttttcaaattaggcgtgttttggtgtcgggctcgtgtcacttttgacatcgacataatatcaatacatataattagattgaattagatg |
36227172 |
T |
|
| Q |
202 |
a |
202 |
Q |
| |
|
| |
|
|
| T |
36227173 |
a |
36227173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 36232417 - 36232380
Alignment:
| Q |
18 |
cactaaacccgtctttgacttgttattgagaatacatt |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36232417 |
cactaaacccgtttttgacttgttattgagaatacatt |
36232380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University