View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10515_low_11 (Length: 236)
Name: NF10515_low_11
Description: NF10515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10515_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 4291440 - 4291638
Alignment:
| Q |
22 |
tatggaagtagta-gtttacattttgtcaagaaattcagtgttgtgagagccatatgacatcatgcacagcagatgtggcaagcaaaaaacagctgatga |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4291440 |
tatggaagtagtaagtttacattttgtcaagaaattcagtgttgtgagagccatatgacatcatgcacagcagatgtggcaagcaaaaaacagctgatga |
4291539 |
T |
|
| Q |
121 |
aattgaaggctattgagatggcaacatggtcacaaaatttgtgcaaaggcttgcaaaaatttggaagaggtgtatgtctaattccagtgcgatttagat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4291540 |
aattgaaggctattgagatggcaacatggtcacaaaatttgtgcaaaggcttgcaaaaatttggaagaggtgtatgtctaattccagtgcgatttagat |
4291638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University