View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10516_low_6 (Length: 236)
Name: NF10516_low_6
Description: NF10516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10516_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 40621841 - 40621635
Alignment:
| Q |
18 |
acattattattataaaaccctttccttcattctgttccaacaattactcaattttattccatttcaacctgaattttgtggtcaannnnnnncttcttct |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40621841 |
acattattattataaaacccttcccttcattctgttccaacaattattcaattttattccatttcaacctgaattttgtggtcaatttttttcttcttct |
40621742 |
T |
|
| Q |
118 |
tcttcagaagatgggtttagtagaaaggtcaaagnnnnnnncccatttatggaagaaagcaatgcttcatttttctttatgttttgtgatgggttttttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40621741 |
tcttcagaagatgggtttagtagaaaggtcaaagaaaaaaacccatttatggaagaaagcaatgcttcatttttctttatgttttgtgatgggttttttc |
40621642 |
T |
|
| Q |
218 |
acaggtt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
40621641 |
acaggtt |
40621635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University