View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10517_high_12 (Length: 201)
Name: NF10517_high_12
Description: NF10517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10517_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 45933021 - 45933194
Alignment:
| Q |
20 |
catgcaatgttgcaaacagttgttaacatggaataagctagcccttgatagggtgggaaatgcaagccat---------gaatgaataatgtgatgggat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45933021 |
catgcaatgttgcaaacagttgttaacatggaataagctagcccttgatagggtgggaaatgcaagccatgaataccatgaatgaataatgtgatgggat |
45933120 |
T |
 |
| Q |
111 |
gggacccttttatttattgtgtttgttatgacttgaatttcgcatagattgccagctatagatcctgctttcat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45933121 |
gggacccttttatttattgtgtttgttatgacttgaatttcgcatagattgccagctatagatcctgctttcat |
45933194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University