View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10517_high_2 (Length: 344)
Name: NF10517_high_2
Description: NF10517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10517_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 18 - 331
Target Start/End: Original strand, 52165272 - 52165585
Alignment:
| Q |
18 |
ccattcaactccaccttcgactcccctgaatcctactccctcgatgaaatcgtttatcgcagcaactccggcggcctccttgacgtccaccatgacatcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52165272 |
ccattcaactccaccttcgactcccctgaatcctactccctcgatgaaatcgtttatcgcagcaactccggcggcctccttgacgtccaccatgacatcg |
52165371 |
T |
 |
| Q |
118 |
aagcactggcaaaattcgacggcgcgtactggcgcaacctattcgattcgcgcgtgggtaaaaccacttggccttatggttcaggtgtatggagcaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52165372 |
aagcactggcaaaattcgacggcgcgtactggcgcaacctattcgattcgcgcgtgggtaaaaccacttggccttatggttcaggtgtatggagcaaaaa |
52165471 |
T |
 |
| Q |
218 |
ggaatgggtcctaccagaaatccaccctgatgatatcgttagcgcttttgaaggtaactctaatcttttctgggctgaacgttttggcaaacagtttgta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52165472 |
ggaatgggtcctaccagaaatccaccctgatgatatcgttagcgcttttgaaggtaactctaatcttttctgggctgaacgttttggcaaacagtttgta |
52165571 |
T |
 |
| Q |
318 |
ggcatgaacgatct |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52165572 |
ggcatgaacgatct |
52165585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 129 - 324
Target Start/End: Original strand, 42663291 - 42663486
Alignment:
| Q |
129 |
aaattcgacggcgcgtactggcgcaacctattcgattcgcgcgtgggtaaaaccacttggccttatggttcaggtgtatggagcaaaaaggaatgggtcc |
228 |
Q |
| |
|
|||||||||||||| || ||||| ||||| |||||||| ||||| |||||||| || ||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
42663291 |
aaattcgacggcgcttattggcgtaacctcttcgattcacgcgtcggtaaaactacatggccttatgggtctggtgtttggagcaaaaaggaatgggttt |
42663390 |
T |
 |
| Q |
229 |
taccagaaatccaccctgatgatatcgttagcgcttttgaaggtaactctaatcttttctgggctgaacgttttggcaaacagtttgtaggcatga |
324 |
Q |
| |
|
| || || ||| | ||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42663391 |
tgcctgagatcgatgatgatgatattgttagtgcttttgaaggtaattctaatcttttttgggctgaacgttttggcaaacagtttctaggcatga |
42663486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University