View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10517_low_2 (Length: 357)
Name: NF10517_low_2
Description: NF10517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10517_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 12086255 - 12086504
Alignment:
| Q |
18 |
gtatttcacttgaatgtgaaaactcttcattagattgaatatctaattgtataaatggagcaatattgctagttttgaaccacttttcagatgaagagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
12086255 |
gtatttcacttgaatgtgaaaactcttcattagattgaatatctaattgtataaatggagcaatattgcttgtttttaaccacttttcagatgaagagtg |
12086354 |
T |
 |
| Q |
118 |
ttcaaaggattcaaaattgaaatctgagattgctgaattatccaatggtgaaagatctataacctccttagacatatttgtgaccaaatttttggttctg |
217 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||| || |
|
|
| T |
12086355 |
atcaaaggattcaaagttcaaatcaaagattgctgaattatccaatggtgaaagttctataacctctttagacatatctgtgaccaaatttttggttttg |
12086454 |
T |
 |
| Q |
218 |
gtttcatcactatctgataaagatt-caaaacattactactattagtttc |
266 |
Q |
| |
|
||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
12086455 |
gtttcatcactatctgataaagattccaaaaaactactactattagtttc |
12086504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 342
Target Start/End: Original strand, 12086544 - 12086580
Alignment:
| Q |
306 |
tattttgtgataggtttttgtgtgttcacctttgctt |
342 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12086544 |
tatttagtgataggtttttgtgtgttcacctttgctt |
12086580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University