View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_15 (Length: 273)
Name: NF10518_low_15
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 113 - 259
Target Start/End: Complemental strand, 42832620 - 42832474
Alignment:
| Q |
113 |
aaaggaatgtttgttatattagagatgcttgtaatttaaaatgttcaatttcaatgtcgaacccgtttctctaattttcttcgtttgtaattgtctagtc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42832620 |
aaaggaatgtttgttatattagagatgcttgtaatttaaaatgttcaatttcaatgtcgaacccgtttctctaattttcttcgtttgtaattgtctaatc |
42832521 |
T |
|
| Q |
213 |
gaaaaagaaatattcaaatttcctaactttcattcgaattctctctc |
259 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42832520 |
gaaaaagaaatattcgaatttcctaactttcattcgaattctctctc |
42832474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 42832992 - 42832893
Alignment:
| Q |
18 |
aattctgcgtggtagatcaacttagaatannnnnnnngtgaggtcaattgctctattttttggtgtttttaagatatcaagattcaagacaccagaaagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
42832992 |
aattctgcgtggtagatcaacttagaatatttttgttgtgaggtcaattgctctattttttggtgtttttgagatatcaagattcaagacaacagaaagg |
42832893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University