View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_17 (Length: 261)
Name: NF10518_low_17
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 35381777 - 35382021
Alignment:
| Q |
7 |
cctcttcctttactaaagcaaaacaatacattaatataacaacattcttcaatggcatcatcaaagccagtttctgtactcttgttaaccattacaatga |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35381777 |
cctcttcctttaccaaagcaaaacaataccttaatataacaacattcttcaatggcatcatcaaagccagtttctgtaatcttgttaaccattacaatga |
35381876 |
T |
|
| Q |
107 |
caatgatgaatgtgaatggtcaaggtggtagtgcaagttggtgcgtggtgaggagtgatgcaagctttaatgcattacaaacagcattggattatgcatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35381877 |
caatgatgaatgtgaatggtcaaggtggtagtgcaagttggtgcgtggtgaggagtgatgcaagctttaatgcattacaaacagcattggattatgcatg |
35381976 |
T |
|
| Q |
207 |
tggagcaggtgctgattgtcttcctcttcaaccagatggcctttg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35381977 |
tggagcaggtgctgattgtcttcctcttcaaccagatggactttg |
35382021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University