View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_20 (Length: 249)
Name: NF10518_low_20
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 9147992 - 9148231
Alignment:
| Q |
1 |
gagttaaaaagcagagaagaatatgaatcttgcaatatgagcaaccctatcaagatgtacactgaaggtttacatacaatcccacttgagaaggaaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147992 |
gagttaaaaagcagagaagaatatgaatcttgcaatatgagcaaccctatcaagatgtacactgaaggtttacatacaatcccacttgagaaggaaggaa |
9148091 |
T |
|
| Q |
101 |
taagatactttgtgagtagtgactctgagaattgcaagaatggtctcaaactcaatgttgaggttcaacctaaggactcacctttacatgccttacccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9148092 |
taagatactttgtgagtagtgactctgagaattgcaagaatggtctcaaactcaatgttgaggttcaacctaaggactcacctttacatgccttacccat |
9148191 |
T |
|
| Q |
201 |
cactcaaactgctgtggctgatggccccactgcttcttct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
9148192 |
cactcaaactgctgtggctgatggccccacttctccttct |
9148231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University