View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_25 (Length: 235)
Name: NF10518_low_25
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 180
Target Start/End: Original strand, 2968110 - 2968278
Alignment:
| Q |
13 |
agatgaatggtgtgatgttaagagatcactttagtagattatacaatttgactagtgataaaaatgttattgttgttgatatgatgttgaatgatggaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2968110 |
agatgaatggtgtgatgttaagagatcactttagtagattatacaatttgactagtgataaaaatgttattgttgttgatatgatgttgaatgatggaga |
2968209 |
T |
|
| Q |
113 |
tgaaagtgaatttaggtagagttggaagcataagttatttcaatgg-aagatgaattgaatgtcaagtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2968210 |
tgaaagtgaatttaggtagagttggaagcataagttatttcaatggaaagatgaattgaatgtcaagtg |
2968278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 108
Target Start/End: Complemental strand, 16905249 - 16905207
Alignment:
| Q |
66 |
agtgataaaaatgttattgttgttgatatgatgttgaatgatg |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
16905249 |
agtgataaaaatgttaatgttgttgatatagtgttgaatgatg |
16905207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University