View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_26 (Length: 232)
Name: NF10518_low_26
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_26 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 232
Target Start/End: Complemental strand, 9998489 - 9998262
Alignment:
| Q |
5 |
gtacaaaacatctaaccaaacatgtgttagatgtatgtttggtatcacgatggatatattatatatcagaactacggtgatttgttgtgattttgcataa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9998489 |
gtacaaaacatctaaccaaacatgtgttagatgtatgtttggtatcacgatggatatattatatatcagaactacggtgatttgtcgtgattttgcataa |
9998390 |
T |
|
| Q |
105 |
gctacaacgataagtcatcataattctcacacacttaccgtgatattaaacatagaccaagagtagtgggagtgtgagaatattgatacttatctttaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9998389 |
gctacaacgataagtcatcataattctcacacacttaccgtgatatcaaacatagactaagagtagtgggagtgtgagaatattgatacttatctttaat |
9998290 |
T |
|
| Q |
205 |
agatgagtttgacttctgtaggaggtaa |
232 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
9998289 |
atatgagtttgacttctgtaggaggtaa |
9998262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University