View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_28 (Length: 226)
Name: NF10518_low_28
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 50 - 212
Target Start/End: Complemental strand, 37042012 - 37041850
Alignment:
| Q |
50 |
gtacctccttgtttgttctcatttgttagtcaacaaacttaaaggtgttttgattttgaagtatggcattacgtatttgatttctcttcgattacaagtg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37042012 |
gtacctccttgtttgttctcatttgttagtcaacaaacttaaaggtgttttgattttgaagtatggcattacttatttgatttctcttcgattacaagtg |
37041913 |
T |
|
| Q |
150 |
cttttgtagtcactgttagttggaatgactatgaggctattaacctgaagatgtgttggaact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37041912 |
cttttgtagtcactgttagttggaatgactatgaggctattaacctgaagatgtgttggaact |
37041850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University