View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_29 (Length: 220)
Name: NF10518_low_29
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 9826098 - 9826291
Alignment:
| Q |
12 |
gcaaagggcaactatgctaatactatcatcaaaatagttttcatcatggagagggaatgtgatctctgtggcgtcgatggtggtgcaactggtgaagaat |
111 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9826098 |
gcaaaaggcaactatgctaatacgatcatcaaaatagttttcaccatggagagggaatgtgatctctgtggcgtcgatggtggtgcaactggtgaagaat |
9826197 |
T |
 |
| Q |
112 |
gttcgcagaggataaatagagaagtcggatggattgttctcggattgtctaatgagactatggttcatggttgacgacatgcaacgaaggtgtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9826198 |
gttcgcagaggataaatagagaagtcggatggattgttctcggattgttgaatgagactatggttcatggttgacgacatgcagcgaaggtgtt |
9826291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 194
Target Start/End: Original strand, 9820460 - 9820615
Alignment:
| Q |
42 |
aaaatagttttcatcatggagagggaatgtgatctctgtggcgtcgatggt----ggtgcaactggtgaagaatgttcgcagaggataaatagagaagtc |
137 |
Q |
| |
|
|||| |||||||| | |||||||||||||| ||||||||||| ||| | || |||||||| |||||| ||| |||||| |||||| |||||||| |
|
|
| T |
9820460 |
aaaacagttttcaccgtggagagggaatgttatctctgtggcatcg-tcgtcatcggtgcaaccattgaagattgtgcgcagatgataaagagagaagta |
9820558 |
T |
 |
| Q |
138 |
ggatggattgttctcggattgtctaatgagactatggttcatggttgacgacatgca |
194 |
Q |
| |
|
|||| ||||||| || ||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
9820559 |
caatgggttgttctttgactgttgaatgagattgtggttcatggttgacgacatgca |
9820615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University