View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_35 (Length: 201)
Name: NF10518_low_35
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 28929627 - 28929454
Alignment:
| Q |
12 |
caaaggatccgacggttatagttttggattggaagattaaggtttgtcactcacttgttcttatcgtgaggcgaatttttgtgcggacgtggttgctaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28929627 |
caaaggatccgacggttatagttttggattggaagattaaggtttgtcactcacttgttcttatcgtgaggcgaatttttgtgcggacgtggttgctaaa |
28929528 |
T |
|
| Q |
112 |
atgggctaggatcatgagcatgttttgatgatatatgagtaatgtcttactcgaattagttatttattgctagt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28929527 |
atgggctaggatcatgagcatgttttgatgatatatgagtaatgtcttactcgaattagttatttattgctagt |
28929454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University