View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_8 (Length: 332)
Name: NF10518_low_8
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 332
Target Start/End: Complemental strand, 35816694 - 35816380
Alignment:
| Q |
18 |
ggaagcacgacagtggcataagggggtctttgttttatatgtagtagtagatactagtttgacaggcttgtagtagataatatatccttttgaaaatcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35816694 |
ggaagcacgacagtggcataagggggtctttgttttatatgtagtagtagatactagtttgacaggcttgtagtagttaatatatccttttgaaaatcgg |
35816595 |
T |
|
| Q |
118 |
tatggtgataatgatattgtgtgcaacattaaccattttaagcattgattttgcagcattccgttctctattgatgacatgttgaaatccagggagcaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35816594 |
tatggtgataatgatattgtgtgcaacattaaccattttaagcattgattttgcagcattccgttctctattgatgacatgttgaaatccagggagcaga |
35816495 |
T |
|
| Q |
218 |
tagatatctcagatattgagactctagtacgtgaaaactctgctttagctaattcttaccttgctcggatcgacaacttttattgtggaattgactgccc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35816494 |
tagatatctcagatattgagactctagtacgtgaaaactctgctttagctaattcttaccttgctcggatcgacaacttttattgtggaattgactgccc |
35816395 |
T |
|
| Q |
318 |
ctgcactcctatgct |
332 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
35816394 |
ctgcactcttatgct |
35816380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University