View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10518_low_9 (Length: 318)
Name: NF10518_low_9
Description: NF10518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10518_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 151 - 306
Target Start/End: Original strand, 35380 - 35535
Alignment:
| Q |
151 |
gccatccatctcaacaatattttcttttttctttcagccagcacgttaactggctgccattttgctgttaccgctctcgttggtatactctccaatgcta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380 |
gccatccatctcaacaatattttcttttttctttcagccagcacgttaactggctgccattttgctgttaccgctctcgttggtatactctccaatgcta |
35479 |
T |
|
| Q |
251 |
ccggttactcgtcttcatcaaagcatgtccctatgtgggagcttctttggttctct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35480 |
ccggttactcgtcttcatcaaagcatgtccctatgtgggagcttctttggttctct |
35535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 35238 - 35356
Alignment:
| Q |
17 |
atgaacattgtcagctccgttggaattatcatcgccaacaaacaactcatgtccaacaatggctatgttttcacttttggtcagccaccttctctcacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35238 |
atgaacattgtcagctccgttggaattatcatcgctaacaaacaactcatgtccaacaatggctatgttttcacttttggtcagccaccttctctcacac |
35337 |
T |
|
| Q |
117 |
attcattcattgttgatgt |
135 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35338 |
attcattcattgttgatgt |
35356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 8677519 - 8677443
Alignment:
| Q |
17 |
atgaacattgtcagctccgttggaattatcatcgccaacaaacaactcatgtccaacaatggctatgttttcacttt |
93 |
Q |
| |
|
|||||| |||| || ||||||||||||||||| || || ||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
8677519 |
atgaacgttgtgagttccgttggaattatcatggctaataaacagcttatgtccaacaatggctatgctttcacttt |
8677443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University