View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10519_high_4 (Length: 236)
Name: NF10519_high_4
Description: NF10519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10519_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 29444391 - 29444332
Alignment:
| Q |
101 |
ttgagaaaatttaatagaatttcacttgagaatcaa-tatgagacactcattaacatttt |
159 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | ||||||| | ||||||||||| |
|
|
| T |
29444391 |
ttgagaaaatttaatagaattccacttgagaatcaattttgagacaatgattaacatttt |
29444332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 29444074 - 29444037
Alignment:
| Q |
185 |
cgaagagtcacttttttcctctacttggcgttaaggat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29444074 |
cgaagagtcacttttttcctctacttggctttaaggat |
29444037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 41
Target Start/End: Complemental strand, 29444430 - 29444394
Alignment:
| Q |
5 |
atgaattctctcaagtataattcccttaattttatat |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29444430 |
atgaattctctcaagtataattcccttaattatatat |
29444394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 128
Target Start/End: Complemental strand, 8004837 - 8004801
Alignment:
| Q |
92 |
atgtaacaattgagaaaatttaatagaatttcacttg |
128 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
8004837 |
atgtaacaattgagaaaatttaagaaaatttcacttg |
8004801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University