View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10519_low_12 (Length: 242)
Name: NF10519_low_12
Description: NF10519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10519_low_12 |
 |  |
|
| [»] scaffold1301 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold1301 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 200 - 425
Alignment:
| Q |
17 |
cacttacgcatcctgatctcaagccttttaattctttaattatattaatgacgctcctatgttgagaagaaagatctttcagaacctgagaagtagaagt |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
200 |
cacttacacatcctgatctcaagccttttaattctttaattatattaatgacgctcctatgttgagaagaaagatcattcagaacctgagaagtagaagt |
299 |
T |
 |
| Q |
117 |
tagtagtgtttcataccgtgcatcaactttgcagcgcaacgcatactttatatcaccaaacaaatagttaacattcgagacagcatttttgagcctattc |
216 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
300 |
tagtactgtttcataccgtgcttcaagtttgcagcgcaacgcatactttatataaccaaacaaatagttaacattcgagacagcatttttgagcctgttc |
399 |
T |
 |
| Q |
217 |
aaccatacatgtacgctaacagcatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
400 |
aaccatacatgtacgctaacagcatc |
425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 68
Target Start/End: Complemental strand, 17311370 - 17311327
Alignment:
| Q |
25 |
catcctgatctcaagccttttaattctttaattatattaatgac |
68 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
17311370 |
catcctgaactcaagccttttagttctttaattaaattaatgac |
17311327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University