View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10519_low_15 (Length: 236)

Name: NF10519_low_15
Description: NF10519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10519_low_15
NF10519_low_15
[»] chr5 (1 HSPs)
chr5 (10-225)||(9967152-9967368)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 9967368 - 9967152
Alignment:
10 agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9967368 agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta 9967269  T
110 gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaa-gaaaatat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
9967268 gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaaggaaaatat 9967169  T
209 acaagacttctgtgctg 225  Q
    |||||||||||||||||    
9967168 acaagacttctgtgctg 9967152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University