View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10519_low_6 (Length: 267)
Name: NF10519_low_6
Description: NF10519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10519_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 6135730 - 6135496
Alignment:
| Q |
19 |
gagcaatcttgcaagattcaaaaaagtcaccgtggatgaattttatgtcaaatttaaaaatgtgacctcaaaaaatgtctccatatttaggaatatccaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
6135730 |
gagcaatcttgcaagattcaaaaaagtcaccatggataaattttatgtcaaattttaaaatgtggcctcgaaaaatgtctccatatttaggaatatccaa |
6135631 |
T |
|
| Q |
119 |
tgaatcaaagagatgcagcttgaagagttgatattaattgtggtccctatcaatgtcgaattgaaaagtagtccttcaatggagataaacatcccagaaa |
218 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6135630 |
tgaatcaatgagatgcagctcgaagagttgatattaattgtggtccctatcaatgtcgaattgaaaagtagtccttcaatggagataaacatcccagaaa |
6135531 |
T |
|
| Q |
219 |
atttcaagcatattattggtacaaaatgttcccttcat |
256 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6135530 |
atttcaagca---tattggtacaaaatgttcccttcat |
6135496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University