View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10519_low_7 (Length: 250)
Name: NF10519_low_7
Description: NF10519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10519_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 31706633 - 31706875
Alignment:
| Q |
1 |
caccaaatatagtttaatcattttgcaattttgcaaatgaaaacaagtattagtgtctcaaaactcgatttattaaaattacctttgcgagttcgtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31706633 |
caccaaatatagtttaatcattttgcaattttgcaaatgaaaacaagtattagtgtctcaaaactcgatttattaaaattacctttgcgagttcgtttga |
31706732 |
T |
 |
| Q |
101 |
gtaattcagttcctctagcaagaagttcttggctgcaagtacttagaaaattatctgcattgataacctctcctccactttcactagtgctagaactact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31706733 |
gtaattcagttcctctagcaagaagttcttggctgcaagtactcagaaaattatctgcattgataacctctcctccactttcactagtgctagaactact |
31706832 |
T |
 |
| Q |
201 |
gttgttattacctttaccaccacatattccaattcctatgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31706833 |
gttgttattacctttaccaccacatattccaattcctatgctt |
31706875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University