View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1051_low_12 (Length: 251)
Name: NF1051_low_12
Description: NF1051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1051_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 32737509 - 32737297
Alignment:
| Q |
1 |
tgtctttttaggcatcaagttcaatcccgagacccaatttaagtcgtacgagatacatgtcattttatccaagcattattgggttatgatctgatatctt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32737509 |
tgtctttttaggcatcgagttcaatcccgagacccaatttaagtcgtaagagatacatgtcattttatccaagcattattgggttatgatctgatatctt |
32737410 |
T |
|
| Q |
101 |
taattgttaacattcatttggaaacccctatacctaatagaaagctgatggaaagtggcgtaattgggatagggagacctaccatgctccttttcttaaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32737409 |
taattgttaacatttatttggaaacccctatacctaatagaaagctgatggaaagtggcgtaattgggatagggagacctaccatgctccttttcttaaa |
32737310 |
T |
|
| Q |
201 |
tctctacatgtgg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32737309 |
tctctacatgtgg |
32737297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 211 - 244
Target Start/End: Complemental strand, 32737286 - 32737253
Alignment:
| Q |
211 |
tggtctcccttggacagaccagggttctgtggtg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32737286 |
tggtctcccttggacagaccagggttctgtggtg |
32737253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University