View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1051_low_13 (Length: 234)

Name: NF1051_low_13
Description: NF1051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1051_low_13
NF1051_low_13
[»] chr5 (1 HSPs)
chr5 (1-133)||(13283545-13283677)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 13283677 - 13283545
Alignment:
1 gaaaatgatttgttgatgatttagtgaaggtgtaatataagttgatcgatctcaaatcattgctgagattgactgctgcgtgtgttgcattgagagccga 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
13283677 gaaaatgatttgttgatgatttagtgaaggtgtaatgtaagttgatcgatctcaaatcattgctgagattgactgatgcgtgtgttgcattgagagccga 13283578  T
101 accgaagaaacgcagcatcactatacacataac 133  Q
    |||||||||||||||||||||||||||||||||    
13283577 accgaagaaacgcagcatcactatacacataac 13283545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University