View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_high_13 (Length: 240)
Name: NF10521_high_13
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 32377693 - 32377519
Alignment:
| Q |
17 |
aagtaagagataacgatagtagtaactgcaactgcaatttaaaaccatcagacacgcacatggttaattaactacgtaaccatatttttcctaggaatat |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377693 |
aagtaagagatcacgatagtagtaactgcaactgcaatttaaaaccatcagacacgcacatggttaattaactacgtaaccatatttttcctaggaatat |
32377594 |
T |
 |
| Q |
117 |
taattttacatcttcatgcatgcaatggatagcatagaagatttcacacacgaagaactagaagatgatcgtaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377593 |
taattttacatcttcatgcatgcaatggatagcatagaagatttcacacacgaagaactagaagatgatcgtaat |
32377519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University