View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_14 (Length: 347)
Name: NF10521_low_14
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 9084944 - 9084626
Alignment:
| Q |
18 |
ccaaaggatgtgttaaggtttctaatactcaataaacgatatgaagtagcaaatcaatagatgagatgaaactatgattagtggtgtttgaaggctcaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084944 |
ccaaaggatgtgttaaggtttctaatactcaataaacgatatgaagtagcaaatcaatagatgagatgaaactatgattagtggtgtttgaaggctcaca |
9084845 |
T |
|
| Q |
118 |
aaaaccctagcccttatcaaaattgtggttgccaaagagagatcaagaagtccttgatttttgtgagatgttcctttaaattatgaaatcagcgaatttt |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084844 |
agaaccctagcccttatcaaaattgtggttgccaaagagagatcaagaagtccttgatttttgtgagatgttcctttaaattatgaaatcagcgaatttt |
9084745 |
T |
|
| Q |
218 |
atattcgtaactcgtagctttgtgtatgcaagattcccttttccaatagttacattcaaacatcgtgggatgctggtatatttccttaaacccttgcatt |
317 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084744 |
atattcataactcgtagctttgtgtatgcaagattcccttttccaatagttacattcaaacatcgtgggatgctggtatatttccttaaacccttgcatt |
9084645 |
T |
|
| Q |
318 |
ctgctgagaattcgccttt |
336 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9084644 |
ctgctgagaattcaccttt |
9084626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 9079612 - 9079562
Alignment:
| Q |
271 |
attcaaacatcgtgggatgctggtatatttccttaaacccttgcattctgc |
321 |
Q |
| |
|
|||||| |||||||||||||| | | ||||||||||||||||||| ||||| |
|
|
| T |
9079612 |
attcaagcatcgtgggatgctagaaaatttccttaaacccttgcaatctgc |
9079562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University