View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10521_low_27 (Length: 270)

Name: NF10521_low_27
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10521_low_27
NF10521_low_27
[»] chr4 (4 HSPs)
chr4 (127-257)||(38038680-38038810)
chr4 (19-94)||(38038608-38038683)
chr4 (189-253)||(38025340-38025404)
chr4 (189-253)||(38030739-38030803)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 127 - 257
Target Start/End: Original strand, 38038680 - 38038810
Alignment:
127 cttaattagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatgattttactagcttattgggt 226  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
38038680 cttaactagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatcattttactagcttattgggt 38038779  T
227 attatggtataaggtaccacttttttgatgt 257  Q
    |||||||||||||||||||||||||||||||    
38038780 attatggtataaggtaccacttttttgatgt 38038810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 38038608 - 38038683
Alignment:
19 tgtatttcatgattattgacaagaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38038608 tgtatttcatgattattgacaagaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta 38038683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 253
Target Start/End: Original strand, 38025340 - 38025404
Alignment:
189 tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg 253  Q
    ||||||||||| |||| ||||||||| ||||||||||| || |||| ||||||||||||||||||    
38025340 tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg 38025404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 253
Target Start/End: Original strand, 38030739 - 38030803
Alignment:
189 tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg 253  Q
    ||||||||||| |||| ||||||||| ||||||||||| || |||| ||||||||||||||||||    
38030739 tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg 38030803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University