View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_31 (Length: 259)
Name: NF10521_low_31
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 47568996 - 47569229
Alignment:
| Q |
16 |
cttccctctatggtttctgatgtcattggcatctatatagcacttacacttcaaattaatttgatgtccccccactctgataccatacacatgtagttcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47568996 |
cttccctctatggtttctgatgtcattggcatctatatagcacttacacttcaaattaatttgatgtccccccactctgataccatacacatgtagttcc |
47569095 |
T |
|
| Q |
116 |
attttttgaattattaccggtattttcttgttgggaaaaacatgcaatactgatctaaatatgtttatagtttgcacatccttaggtttggctttcttag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
47569096 |
attttttgaattattaccggtattttcttgttgggaaaaacatgcaatactgatctaaatatgtttagagtttgcacatccttagttttgactttcttag |
47569195 |
T |
|
| Q |
216 |
gtttaccaattcattaatcttaagagtacctttg |
249 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |
|
|
| T |
47569196 |
gtttaccaattcataaatcttaagagtgcctttg |
47569229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University