View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_33 (Length: 252)
Name: NF10521_low_33
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 4611483 - 4611713
Alignment:
| Q |
17 |
cagagaaactttaaacactgtacactatgattctcagctatttttt-actttgccttgatgtaatttnnnnnnnntgctgaaaaatatatgcttctaata |
115 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
4611483 |
cagagaaacttcaaacactgtatactatgattctcagctatttttttactttgccttgatgtaatttaaaaaaaatgctgaaaaatatatgcttttaata |
4611582 |
T |
 |
| Q |
116 |
acaggctcagatattgaaaatgaatcacttttgttagannnnnnnnacaagaagcaaaactatctcatcgaaattgactcctgagacacttttcttacag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
4611583 |
acaggctcagatattgaaaatgaatcacttttgttagattttttttacaagaagcaaaactatctcatcgaaattgacacccgagacacttttcttacag |
4611682 |
T |
 |
| Q |
216 |
ttgaagtagataacagagacaaagttgaatg |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
4611683 |
ttgaagtagataacagggacaaagttgaatg |
4611713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University