View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_41 (Length: 240)
Name: NF10521_low_41
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 55060854 - 55060741
Alignment:
| Q |
1 |
gcacttgatttgattgaagctacttatgaaagagaggtttgtcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55060854 |
gcacttgatttgattgaagctacttatgaaagagaggtttatcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctc |
55060755 |
T |
|
| Q |
101 |
gtccagaaccaaaa |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
55060754 |
gtccagaaccaaaa |
55060741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 55060688 - 55060637
Alignment:
| Q |
165 |
ggaaatctgtttatgaatcaagaacatggtttggtgaaatattggctactaa |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55060688 |
ggaaatctgtttatgaatcaagaagatggtttggtgaaatattggctactaa |
55060637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University