View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_44 (Length: 240)
Name: NF10521_low_44
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 2 - 95
Target Start/End: Original strand, 52954428 - 52954521
Alignment:
| Q |
2 |
gatagctgtattagaaaactagaagtaaattataannnnnnnaagtcagagttaagtcttgagtatataattttggtattaggatcctctggga |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52954428 |
gatagctgtattagaaaactagaagtaaattataatttttttaagtcagagttaagtcttgagtatataattttggtattaggatcctctggga |
52954521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 52954518 - 52954595
Alignment:
| Q |
127 |
gggataattttgaaaagnnnnnnnngaagtagatattggttaaaagttgagatgtgaaacttgagaaaacgcaagaga |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52954518 |
gggataattttgaaaagaaaaaaaagaagtagatattggttaaaagttgagatgtgaaacttgagaaaacgcaagaga |
52954595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University