View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_49 (Length: 237)
Name: NF10521_low_49
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_49 |
 | |
|
| [»] scaffold0561 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 12 - 181
Target Start/End: Original strand, 22633362 - 22633527
Alignment:
| Q |
12 |
agcaaaggctttggaggtgtagcagtttggcagtcagtcaggcttgatgccattggtgggattttataccctgtcatgccagtttagatttaaggatcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22633362 |
agcaaaggctttggaggtgtagcagtttggcagt----caggcttgatgccattggtgggattttataccttgtcatgccagtttagatttaaggatcaa |
22633457 |
T |
|
| Q |
112 |
cttagatgnnnnnnnnnngtagagtcttatgtgtattttctctacttttattttaacatcattggaattg |
181 |
Q |
| |
|
||||||| |||| || || | |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22633458 |
tttagatgttttttttttgtagtgtgttctatgtattttctctacttttattttaccatcattggaattg |
22633527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 22648996 - 22649039
Alignment:
| Q |
177 |
aattgatattaccatgagaaaggaatattcatacactattttat |
220 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
22648996 |
aattgatactaccattagaaaggaatattcatacactattttat |
22649039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0561 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0561
Description:
Target: scaffold0561; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 119
Target Start/End: Complemental strand, 1431 - 1363
Alignment:
| Q |
51 |
aggcttgatgccattggtgggattttataccctgtcatgccagtttagatttaaggatcaacttagatg |
119 |
Q |
| |
|
|||||||||||||| |||||| | || ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
1431 |
aggcttgatgccatcggtgggttcttgtaccctgtcataccagtttagagttaaggatcaacttagatg |
1363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University