View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10521_low_52 (Length: 234)

Name: NF10521_low_52
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10521_low_52
NF10521_low_52
[»] chr2 (1 HSPs)
chr2 (15-216)||(155092-155293)
[»] chr4 (1 HSPs)
chr4 (15-182)||(56469295-56469462)
[»] chr6 (1 HSPs)
chr6 (49-164)||(24329119-24329234)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 155092 - 155293
Alignment:
15 caaaggtgtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
155092 caaaggtgtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtt 155191  T
115 tctggtccactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgacagaacatcacggatttccagtagttgatgagc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
155192 tctggtccactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgacagaacatcacggatttccagtagttgatgagc 155291  T
215 ct 216  Q
    ||    
155292 ct 155293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 182
Target Start/End: Complemental strand, 56469462 - 56469295
Alignment:
15 caaaggtgtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtt 114  Q
    |||||||||||||||||| || ||||   |||||||  | |||||| ||||||  |||||||| || ||||||||| |||||||||| || |||||||||    
56469462 caaaggtgtttatgatcaaatagtggaaatgaaggggttgccttatttggaagtgcatgcagaaccgtacatgaggcatttagttgccggtgatgttgtt 56469363  T
115 tctggtccactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgac 182  Q
    ||||||||||||||| | || | ||| || |||||||||||||||||  ||||| |||| || |||||    
56469362 tctggtccactgtttacattctctggtattgaaaaagtggggaatattgtgcacactttaaaggtgac 56469295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 164
Target Start/End: Complemental strand, 24329234 - 24329119
Alignment:
49 ggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtttctggtccactgttttctttttgtgggatcgaaa 148  Q
    ||||| |||||| ||||||||||||| || || |||||||||||| ||| | || | |||||||| || |||||| || |  | |||| ||| |||||||    
24329234 ggacttccttatttggaagcacatgccgaaccttacatgaggaatatagctacacgtgatgttgtctcgggtccattgatgaccttttctggcatcgaaa 24329135  T
149 aagtggggaatatatt 164  Q
    | || |||||||||||    
24329134 aggttgggaatatatt 24329119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University