View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_53 (Length: 229)
Name: NF10521_low_53
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 35351359 - 35351561
Alignment:
| Q |
12 |
caaagggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351359 |
caaagggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtga |
35351458 |
T |
|
| Q |
112 |
tgtttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtacat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35351459 |
tgtttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtgcat |
35351558 |
T |
|
| Q |
212 |
gtg |
214 |
Q |
| |
|
||| |
|
|
| T |
35351559 |
gtg |
35351561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University