View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10521_low_58 (Length: 208)

Name: NF10521_low_58
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10521_low_58
NF10521_low_58
[»] chr8 (1 HSPs)
chr8 (9-84)||(9120632-9120707)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 9120707 - 9120632
Alignment:
9 tagcaaagggaggataaaatacgccgcgagttttgaagttttaatgatgttattgacaactaaaaatctattgtta 84  Q
    ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9120707 tagcaaaagaaggataaaatacgccgcgagttttgaagttttaatgatgttattgacaactaaaaatctattgtta 9120632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University