View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_58 (Length: 208)
Name: NF10521_low_58
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 9120707 - 9120632
Alignment:
| Q |
9 |
tagcaaagggaggataaaatacgccgcgagttttgaagttttaatgatgttattgacaactaaaaatctattgtta |
84 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9120707 |
tagcaaaagaaggataaaatacgccgcgagttttgaagttttaatgatgttattgacaactaaaaatctattgtta |
9120632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University